Test Bank For Genetics: A Conceptual Approach, 6th Edition
Take your exam prep to the next level with Test Bank For Genetics: A Conceptual Approach, 6th Edition—get instant access to essential questions.
Michael Davis
Contributor
4.1
72
about 2 months ago
Preview (31 of 561)
Sign in to access the full document!
Page 1
1. Which of the following statements CORRECTLY describes the facts about introns and
exons?
A) The number of introns is always less than the number of exons in a gene.
B) Introns are degraded in the cytoplasm.
C) All eukaryotic genes contain an intron.
D) Mitochondrial and chloroplast genes do not contain introns.
E) Introns do not contain sequence-specific information.
2. In 1958, Francis Crick proposed that genes and their corresponding polypeptides are
“colinear.” Which of the following statements concerning the concept of colinearity is
INCORRECT?
A) Colinearity means that the linear nucleotide sequence of a given gene corresponds
directly to the linear amino acid sequence in the corresponding polypeptide.
B) The number of nucleotides in a gene should be precisely proportional to the
number of amino acids present in the corresponding polypeptide.
C) Colinearity generally holds true for the coding regions of prokaryotic viral genes.
D) The vast majority of eukaryotic genes follow the concept of colinearity.
E) The exception to colinearity between genes and polypeptides is the presence of
untranslated sequences (UTRs).
3. How many introns are present on a gene that consists of four exons?
A) two
B) three
C) four
D) five
E) The number cannot be determined from the information provided.
4. Which of the following statements regarding gene structure is TRUE?
A) The amino acid sequence of a polypeptide can be precisely predicted by the
nucleotide sequence of the gene that encodes it.
B) The number of introns found in organisms is species specific.
C) The number of exons and introns generally correlates to the complexity of the
organisms.
D) Intron cleavage and exon splicing are both mediated exclusively by protein
enzymes.
E) The number of exons is always less than the number of introns in a gene.
1. Which of the following statements CORRECTLY describes the facts about introns and
exons?
A) The number of introns is always less than the number of exons in a gene.
B) Introns are degraded in the cytoplasm.
C) All eukaryotic genes contain an intron.
D) Mitochondrial and chloroplast genes do not contain introns.
E) Introns do not contain sequence-specific information.
2. In 1958, Francis Crick proposed that genes and their corresponding polypeptides are
“colinear.” Which of the following statements concerning the concept of colinearity is
INCORRECT?
A) Colinearity means that the linear nucleotide sequence of a given gene corresponds
directly to the linear amino acid sequence in the corresponding polypeptide.
B) The number of nucleotides in a gene should be precisely proportional to the
number of amino acids present in the corresponding polypeptide.
C) Colinearity generally holds true for the coding regions of prokaryotic viral genes.
D) The vast majority of eukaryotic genes follow the concept of colinearity.
E) The exception to colinearity between genes and polypeptides is the presence of
untranslated sequences (UTRs).
3. How many introns are present on a gene that consists of four exons?
A) two
B) three
C) four
D) five
E) The number cannot be determined from the information provided.
4. Which of the following statements regarding gene structure is TRUE?
A) The amino acid sequence of a polypeptide can be precisely predicted by the
nucleotide sequence of the gene that encodes it.
B) The number of introns found in organisms is species specific.
C) The number of exons and introns generally correlates to the complexity of the
organisms.
D) Intron cleavage and exon splicing are both mediated exclusively by protein
enzymes.
E) The number of exons is always less than the number of introns in a gene.
Page 1
1. Which of the following statements CORRECTLY describes the facts about introns and
exons?
A) The number of introns is always less than the number of exons in a gene.
B) Introns are degraded in the cytoplasm.
C) All eukaryotic genes contain an intron.
D) Mitochondrial and chloroplast genes do not contain introns.
E) Introns do not contain sequence-specific information.
2. In 1958, Francis Crick proposed that genes and their corresponding polypeptides are
“colinear.” Which of the following statements concerning the concept of colinearity is
INCORRECT?
A) Colinearity means that the linear nucleotide sequence of a given gene corresponds
directly to the linear amino acid sequence in the corresponding polypeptide.
B) The number of nucleotides in a gene should be precisely proportional to the
number of amino acids present in the corresponding polypeptide.
C) Colinearity generally holds true for the coding regions of prokaryotic viral genes.
D) The vast majority of eukaryotic genes follow the concept of colinearity.
E) The exception to colinearity between genes and polypeptides is the presence of
untranslated sequences (UTRs).
3. How many introns are present on a gene that consists of four exons?
A) two
B) three
C) four
D) five
E) The number cannot be determined from the information provided.
4. Which of the following statements regarding gene structure is TRUE?
A) The amino acid sequence of a polypeptide can be precisely predicted by the
nucleotide sequence of the gene that encodes it.
B) The number of introns found in organisms is species specific.
C) The number of exons and introns generally correlates to the complexity of the
organisms.
D) Intron cleavage and exon splicing are both mediated exclusively by protein
enzymes.
E) The number of exons is always less than the number of introns in a gene.
1. Which of the following statements CORRECTLY describes the facts about introns and
exons?
A) The number of introns is always less than the number of exons in a gene.
B) Introns are degraded in the cytoplasm.
C) All eukaryotic genes contain an intron.
D) Mitochondrial and chloroplast genes do not contain introns.
E) Introns do not contain sequence-specific information.
2. In 1958, Francis Crick proposed that genes and their corresponding polypeptides are
“colinear.” Which of the following statements concerning the concept of colinearity is
INCORRECT?
A) Colinearity means that the linear nucleotide sequence of a given gene corresponds
directly to the linear amino acid sequence in the corresponding polypeptide.
B) The number of nucleotides in a gene should be precisely proportional to the
number of amino acids present in the corresponding polypeptide.
C) Colinearity generally holds true for the coding regions of prokaryotic viral genes.
D) The vast majority of eukaryotic genes follow the concept of colinearity.
E) The exception to colinearity between genes and polypeptides is the presence of
untranslated sequences (UTRs).
3. How many introns are present on a gene that consists of four exons?
A) two
B) three
C) four
D) five
E) The number cannot be determined from the information provided.
4. Which of the following statements regarding gene structure is TRUE?
A) The amino acid sequence of a polypeptide can be precisely predicted by the
nucleotide sequence of the gene that encodes it.
B) The number of introns found in organisms is species specific.
C) The number of exons and introns generally correlates to the complexity of the
organisms.
D) Intron cleavage and exon splicing are both mediated exclusively by protein
enzymes.
E) The number of exons is always less than the number of introns in a gene.
Page 2
5. Which of the following statements about bacterial mRNA transcripts is TRUE?
A) Unlike eukaryotes, bacterial mRNA transcripts do not typically contain
untranslated regions.
B) The Shine–Dalgarno sequence associates with an RNA component in the small
subunit of ribosomes.
C) Transcription and translation take place sequentially in bacterial cells.
D) Most of bacterial genes contain a large number of introns and small number of
exons.
E) The 5 end and 3 end of mRNA transcripts are modified in bacteria.
6. Which of the following statements about ribosomes and ribosomal RNA is NOT true?
A) Ribosomes typically contain about 80% of the total cellular RNA.
B) Ribosomal RNA is processed in both prokaryotes and eukaryotes.
C) In eukaryotes, genes for rRNA are usually present within tandem repeats.
D) Each ribosomal RNA component is encoded by a separate gene.
E) In eukaryotes, the rRNA transcripts are processed further by snoRNAs within the
nucleus.
7. The spliceosome is a large, ribonucleoprotein complex located in the:
A) cytoplasm.
B) endoplasmic reticulum.
C) Golgi aparatus.
D) nucleus.
E) nucleolus.
8. The 5 and 3 untranslated regions (UTRs) of processed mRNA molecules are derived
from:
A) exons.
B) introns.
C) promoters.
D) terminators.
E) the protein-coding region.
5. Which of the following statements about bacterial mRNA transcripts is TRUE?
A) Unlike eukaryotes, bacterial mRNA transcripts do not typically contain
untranslated regions.
B) The Shine–Dalgarno sequence associates with an RNA component in the small
subunit of ribosomes.
C) Transcription and translation take place sequentially in bacterial cells.
D) Most of bacterial genes contain a large number of introns and small number of
exons.
E) The 5 end and 3 end of mRNA transcripts are modified in bacteria.
6. Which of the following statements about ribosomes and ribosomal RNA is NOT true?
A) Ribosomes typically contain about 80% of the total cellular RNA.
B) Ribosomal RNA is processed in both prokaryotes and eukaryotes.
C) In eukaryotes, genes for rRNA are usually present within tandem repeats.
D) Each ribosomal RNA component is encoded by a separate gene.
E) In eukaryotes, the rRNA transcripts are processed further by snoRNAs within the
nucleus.
7. The spliceosome is a large, ribonucleoprotein complex located in the:
A) cytoplasm.
B) endoplasmic reticulum.
C) Golgi aparatus.
D) nucleus.
E) nucleolus.
8. The 5 and 3 untranslated regions (UTRs) of processed mRNA molecules are derived
from:
A) exons.
B) introns.
C) promoters.
D) terminators.
E) the protein-coding region.
Page 2
5. Which of the following statements about bacterial mRNA transcripts is TRUE?
A) Unlike eukaryotes, bacterial mRNA transcripts do not typically contain
untranslated regions.
B) The Shine–Dalgarno sequence associates with an RNA component in the small
subunit of ribosomes.
C) Transcription and translation take place sequentially in bacterial cells.
D) Most of bacterial genes contain a large number of introns and small number of
exons.
E) The 5 end and 3 end of mRNA transcripts are modified in bacteria.
6. Which of the following statements about ribosomes and ribosomal RNA is NOT true?
A) Ribosomes typically contain about 80% of the total cellular RNA.
B) Ribosomal RNA is processed in both prokaryotes and eukaryotes.
C) In eukaryotes, genes for rRNA are usually present within tandem repeats.
D) Each ribosomal RNA component is encoded by a separate gene.
E) In eukaryotes, the rRNA transcripts are processed further by snoRNAs within the
nucleus.
7. The spliceosome is a large, ribonucleoprotein complex located in the:
A) cytoplasm.
B) endoplasmic reticulum.
C) Golgi aparatus.
D) nucleus.
E) nucleolus.
8. The 5 and 3 untranslated regions (UTRs) of processed mRNA molecules are derived
from:
A) exons.
B) introns.
C) promoters.
D) terminators.
E) the protein-coding region.
5. Which of the following statements about bacterial mRNA transcripts is TRUE?
A) Unlike eukaryotes, bacterial mRNA transcripts do not typically contain
untranslated regions.
B) The Shine–Dalgarno sequence associates with an RNA component in the small
subunit of ribosomes.
C) Transcription and translation take place sequentially in bacterial cells.
D) Most of bacterial genes contain a large number of introns and small number of
exons.
E) The 5 end and 3 end of mRNA transcripts are modified in bacteria.
6. Which of the following statements about ribosomes and ribosomal RNA is NOT true?
A) Ribosomes typically contain about 80% of the total cellular RNA.
B) Ribosomal RNA is processed in both prokaryotes and eukaryotes.
C) In eukaryotes, genes for rRNA are usually present within tandem repeats.
D) Each ribosomal RNA component is encoded by a separate gene.
E) In eukaryotes, the rRNA transcripts are processed further by snoRNAs within the
nucleus.
7. The spliceosome is a large, ribonucleoprotein complex located in the:
A) cytoplasm.
B) endoplasmic reticulum.
C) Golgi aparatus.
D) nucleus.
E) nucleolus.
8. The 5 and 3 untranslated regions (UTRs) of processed mRNA molecules are derived
from:
A) exons.
B) introns.
C) promoters.
D) terminators.
E) the protein-coding region.
Page 3
9. Which of the following statements about group I and group II introns is NOT true?
A) Both group I and II introns form elaborate and characteristic secondary structures
with loops.
B) The splicing mechanism of group II introns is similar to that of
spliceosome-mediated nuclear pre-mRNA splicing.
C) The length of group I and group II introns is much longer than the exons within the
structures.
D) Group I and group II introns are exclusively found in mitochondrial and chloroplast
encoded genes.
E) Both group I and group II introns are both found in bacterial genes.
10. Which of the following statements BEST explains why only pre-mRNA receives a 5
cap?
A) The enzyme that initiates the capping step is known to associate with RNA
polymerase II, which generates pre-mRNAs.
B) Only pre-mRNAs contain proper sequences for the cap to be added on.
C) The tail of the pre-mRNA can recruit the right combination of enzymes for
capping.
D) Nuclear pore complexes only recognize pre-mRNAs and allow them out to the
cytoplasm for the capping process to begin.
E) rRNA and tRNAs do not exit the nucleus to receive the cap via enzymes in the
cytoplasm.
11. Which of the following phenomena is NOT affected by the presence of alternative
splicing?
A) speciation
B) development
C) organismal complexity
D) tissue specificity
E) RNA interference
12. Which of the following spliceosomal components specifically recognizes and binds to
the branch point of the intron during pre-mRNA splicing?
A) U1
B) U2
C) U5
D) U6
E) spliceosomal proteins
9. Which of the following statements about group I and group II introns is NOT true?
A) Both group I and II introns form elaborate and characteristic secondary structures
with loops.
B) The splicing mechanism of group II introns is similar to that of
spliceosome-mediated nuclear pre-mRNA splicing.
C) The length of group I and group II introns is much longer than the exons within the
structures.
D) Group I and group II introns are exclusively found in mitochondrial and chloroplast
encoded genes.
E) Both group I and group II introns are both found in bacterial genes.
10. Which of the following statements BEST explains why only pre-mRNA receives a 5
cap?
A) The enzyme that initiates the capping step is known to associate with RNA
polymerase II, which generates pre-mRNAs.
B) Only pre-mRNAs contain proper sequences for the cap to be added on.
C) The tail of the pre-mRNA can recruit the right combination of enzymes for
capping.
D) Nuclear pore complexes only recognize pre-mRNAs and allow them out to the
cytoplasm for the capping process to begin.
E) rRNA and tRNAs do not exit the nucleus to receive the cap via enzymes in the
cytoplasm.
11. Which of the following phenomena is NOT affected by the presence of alternative
splicing?
A) speciation
B) development
C) organismal complexity
D) tissue specificity
E) RNA interference
12. Which of the following spliceosomal components specifically recognizes and binds to
the branch point of the intron during pre-mRNA splicing?
A) U1
B) U2
C) U5
D) U6
E) spliceosomal proteins
Loading page 4...
Page 4
13. The human gene encoding calcitonin contains six exons and five introns and is located
on chromosome 11. The pre-mRNA transcript from this gene can generate either
calcitonin or calcitonin gene-related peptide (CGRP) in a tissue-specific manner.
Calcitonin produced from the thyroid gland is 32 amino acids long and functions to
regulate the calcium while CGRP, which contains 37 amino acids, is produced by the
brain cells and involved in transmission of pain. Which of the following processes
makes production of two functionally and structurally different proteins from the same
gene possible?
A) self-spicing introns
B) differential transcription
C) alternative replication
D) 5 capping and polyadenylation
E) alternative RNA processing
14. Guide RNAs are needed in:
A) transcription.
B) translation.
C) RNA interference.
D) RNA editing.
E) RNA splicing.
15. Which mechanism allows for more than one polypeptide to be encoded by a single
gene?
A) regulated transcription
B) RNA interference
C) alternative RNA processing
D) self-splicing of introns
E) RNA methylation
16. Which of the following elements would NOT be found in an mRNA molecule?
A) protein-coding region
B) 3 untranslated region
C) 5 untranslated region
D) promoter
E) start and stop codons
13. The human gene encoding calcitonin contains six exons and five introns and is located
on chromosome 11. The pre-mRNA transcript from this gene can generate either
calcitonin or calcitonin gene-related peptide (CGRP) in a tissue-specific manner.
Calcitonin produced from the thyroid gland is 32 amino acids long and functions to
regulate the calcium while CGRP, which contains 37 amino acids, is produced by the
brain cells and involved in transmission of pain. Which of the following processes
makes production of two functionally and structurally different proteins from the same
gene possible?
A) self-spicing introns
B) differential transcription
C) alternative replication
D) 5 capping and polyadenylation
E) alternative RNA processing
14. Guide RNAs are needed in:
A) transcription.
B) translation.
C) RNA interference.
D) RNA editing.
E) RNA splicing.
15. Which mechanism allows for more than one polypeptide to be encoded by a single
gene?
A) regulated transcription
B) RNA interference
C) alternative RNA processing
D) self-splicing of introns
E) RNA methylation
16. Which of the following elements would NOT be found in an mRNA molecule?
A) protein-coding region
B) 3 untranslated region
C) 5 untranslated region
D) promoter
E) start and stop codons
Loading page 5...
Page 5
17. Which of the following is found in the primary product of transcription but not in a
mature mRNA molecule?
A) start codon
B) promoter
C) exons
D) introns
E) stop codon
18. The information needed during RNA editing comes MOST directly from:
A) pre-mRNA.
B) mRNA.
C) rRNA.
D) tRNA.
E) guide RNA.
19. Scientists once believed that each gene can encode a single polypeptide. We now know
that _____ and _____ allow a single gene to encode more than one polypeptide.
A) transcription; translation
B) polyadenylation; RNA transport
C) DNA methylation; chromatin condensation
D) alternative processing; RNA editing
E) gene silencing; RNA interference
20. Which mechanism allows for the production of polypeptides that are not entirely
encoded by DNA?
A) regulated transcription
B) RNA interference
C) alternative RNA processing
D) RNA editing
E) colinearity
17. Which of the following is found in the primary product of transcription but not in a
mature mRNA molecule?
A) start codon
B) promoter
C) exons
D) introns
E) stop codon
18. The information needed during RNA editing comes MOST directly from:
A) pre-mRNA.
B) mRNA.
C) rRNA.
D) tRNA.
E) guide RNA.
19. Scientists once believed that each gene can encode a single polypeptide. We now know
that _____ and _____ allow a single gene to encode more than one polypeptide.
A) transcription; translation
B) polyadenylation; RNA transport
C) DNA methylation; chromatin condensation
D) alternative processing; RNA editing
E) gene silencing; RNA interference
20. Which mechanism allows for the production of polypeptides that are not entirely
encoded by DNA?
A) regulated transcription
B) RNA interference
C) alternative RNA processing
D) RNA editing
E) colinearity
Loading page 6...
Page 6
21. Below is a list of steps of intron removal and splicing during pre-mRNA processing.
Please select the choice that lists the steps in the CORRECT sequential order.
1. Attachment of snRNP U1 to the 5 splice site
2. Transcription of the DNA template into the pre-mRNA molecule
3. Release of lariat structure
4. Splicing together of exons
5. Transesterification reaction at the branch point adenine
A) 1, 2, 3, 4, 5
B) 4, 1, 3, 5, 2
C) 2, 1, 5, 3, 4
D) 3, 5, 1, 2, 4
E) 5, 3, 4, 1, 2
22. Below is a list of steps of eukaryotic pre-mRNA processing. Please select the choice
that lists the steps in the CORRECT sequential order.
1. Recognition and binding the 3 AAUAAA sequence by specific protein factors
2. Cleavage at the poly(A) site
3. Addition of the 5 cap
4. Export to the cytoplasm
5. Addition of the poly(A) tail
A) 3, 1, 2, 5, 4
B) 2, 3, 4, 5, 1
C) 4, 2, 3, 1, 5
D) 1, 3, 5, 4, 1
E) 5, 4, 1, 3, 2
23. The 5 cap on an mRNA is important for all the processes listed below except for the
_____ of an mRNA molecule.
A) transcription
B) intron removal
C) stability
D) initiation of translation
E) ribosomal interaction
21. Below is a list of steps of intron removal and splicing during pre-mRNA processing.
Please select the choice that lists the steps in the CORRECT sequential order.
1. Attachment of snRNP U1 to the 5 splice site
2. Transcription of the DNA template into the pre-mRNA molecule
3. Release of lariat structure
4. Splicing together of exons
5. Transesterification reaction at the branch point adenine
A) 1, 2, 3, 4, 5
B) 4, 1, 3, 5, 2
C) 2, 1, 5, 3, 4
D) 3, 5, 1, 2, 4
E) 5, 3, 4, 1, 2
22. Below is a list of steps of eukaryotic pre-mRNA processing. Please select the choice
that lists the steps in the CORRECT sequential order.
1. Recognition and binding the 3 AAUAAA sequence by specific protein factors
2. Cleavage at the poly(A) site
3. Addition of the 5 cap
4. Export to the cytoplasm
5. Addition of the poly(A) tail
A) 3, 1, 2, 5, 4
B) 2, 3, 4, 5, 1
C) 4, 2, 3, 1, 5
D) 1, 3, 5, 4, 1
E) 5, 4, 1, 3, 2
23. The 5 cap on an mRNA is important for all the processes listed below except for the
_____ of an mRNA molecule.
A) transcription
B) intron removal
C) stability
D) initiation of translation
E) ribosomal interaction
Loading page 7...
Page 7
24. A key modification in the 3 end of eukaryotic mRNA is the addition of 50 to 250
adenine nucleotides, forming a poly(A) tail. Which of the following is NOT a function
of the poly(A) tail?
A) The stability of mRNA transcripts in the cytoplasm is affected by the poly(A) tail.
B) The poly(A) tail facilitates the attachment of the ribosome to the mRNA.
C) The poly(A) tail is important for proper nuclear export of the mRNA.
D) The poly(A) tail at the 3 end translates to a long stretch of repeated amino acids.
E) Multiple proteins will recognize and bind to the poly(A) tail in the cytoplasm.
25. During the posttranscriptional processing of pre-mRNA, a 5 cap is added to an
mRNA. Arrange the following steps of the capping process in the CORRECT order.
1. Addition of a guanine nucleotide via a 5-5 bond
2. Removal of a phosphate from a ribonucleotide triphosphate at the 5 head of the
pre-mRNA
3. Methylation at the 2 position of the sugar in the second and the third nucleotides
4. Methylation at position 7 of the terminal guanine base
A) 1, 2, 3, 4
B) 2, 4, 1, 3
C) 4, 1, 3, 2
D) 2, 1, 4, 3
E) 3, 2, 4, 1
26. During the posttranscriptional processing of pre-mRNA, a 5 cap is added to an mRNA
in step-by-step manner. Which of the following reasons prevents the 5 capping
process, involving methylation, from occurring on a DNA strand?
A) lack of an OH group on the 2 carbon of the deoxyribose
B) lack of an OH group on the 3 carbon of the deoxyribose
C) lack of a uracil nitrogenous base on the DNA strand
D) lack of GTP hydrolysis associated with DNA transcription
E) lack of a H on the 4 carbon of the deoxyribose
27. Which of the following consensus sequences are NOT found in nuclear introns?
A) GU at the 5 splice site at the beginning of the intron
B) AG at the 3 splice site at the end of the intron
C) CCA at the 3 site downstream of the branch point
D) a at the lariat branch point site
E) 3 CAGG consensus sequence at the 3 splice site
24. A key modification in the 3 end of eukaryotic mRNA is the addition of 50 to 250
adenine nucleotides, forming a poly(A) tail. Which of the following is NOT a function
of the poly(A) tail?
A) The stability of mRNA transcripts in the cytoplasm is affected by the poly(A) tail.
B) The poly(A) tail facilitates the attachment of the ribosome to the mRNA.
C) The poly(A) tail is important for proper nuclear export of the mRNA.
D) The poly(A) tail at the 3 end translates to a long stretch of repeated amino acids.
E) Multiple proteins will recognize and bind to the poly(A) tail in the cytoplasm.
25. During the posttranscriptional processing of pre-mRNA, a 5 cap is added to an
mRNA. Arrange the following steps of the capping process in the CORRECT order.
1. Addition of a guanine nucleotide via a 5-5 bond
2. Removal of a phosphate from a ribonucleotide triphosphate at the 5 head of the
pre-mRNA
3. Methylation at the 2 position of the sugar in the second and the third nucleotides
4. Methylation at position 7 of the terminal guanine base
A) 1, 2, 3, 4
B) 2, 4, 1, 3
C) 4, 1, 3, 2
D) 2, 1, 4, 3
E) 3, 2, 4, 1
26. During the posttranscriptional processing of pre-mRNA, a 5 cap is added to an mRNA
in step-by-step manner. Which of the following reasons prevents the 5 capping
process, involving methylation, from occurring on a DNA strand?
A) lack of an OH group on the 2 carbon of the deoxyribose
B) lack of an OH group on the 3 carbon of the deoxyribose
C) lack of a uracil nitrogenous base on the DNA strand
D) lack of GTP hydrolysis associated with DNA transcription
E) lack of a H on the 4 carbon of the deoxyribose
27. Which of the following consensus sequences are NOT found in nuclear introns?
A) GU at the 5 splice site at the beginning of the intron
B) AG at the 3 splice site at the end of the intron
C) CCA at the 3 site downstream of the branch point
D) a at the lariat branch point site
E) 3 CAGG consensus sequence at the 3 splice site
Loading page 8...
Page 8
28. What do group I and group II introns have in common?
A) Both are found in mitochondrial genes.
B) Both are found in bacteriophages.
C) Both are known to be self-splicing introns.
D) Both are found in protein-coding genes of chloroplasts.
E) Both are frequently found in eukaryotic genes.
29. Which of the following statements CORRECTLY describes the concept of alternative
splicing?
A) Eukaryotic gene and protein sequences are precisely colinear.
B) With the rare exception of RNA editing, every nucleotide contained in a processed
mRNA molecule is derived from exon sequences.
C) Every other intron is removed in an alternate manner to generate a functional
mRNA transcript.
D) Only a subset of the same mRNA transcripts is specifically selected for splicing in
the nucleus.
E) Multiple protein products are often produced from single eukaryotic genes.
30. Given the figure below, within which of the following would the 5ʹ untranslated region
be located?
A) promoter
B) exon 1
C) exon 4
D) intron 1
E) A 5ʹ untranslated region would not be present in this figure.
28. What do group I and group II introns have in common?
A) Both are found in mitochondrial genes.
B) Both are found in bacteriophages.
C) Both are known to be self-splicing introns.
D) Both are found in protein-coding genes of chloroplasts.
E) Both are frequently found in eukaryotic genes.
29. Which of the following statements CORRECTLY describes the concept of alternative
splicing?
A) Eukaryotic gene and protein sequences are precisely colinear.
B) With the rare exception of RNA editing, every nucleotide contained in a processed
mRNA molecule is derived from exon sequences.
C) Every other intron is removed in an alternate manner to generate a functional
mRNA transcript.
D) Only a subset of the same mRNA transcripts is specifically selected for splicing in
the nucleus.
E) Multiple protein products are often produced from single eukaryotic genes.
30. Given the figure below, within which of the following would the 5ʹ untranslated region
be located?
A) promoter
B) exon 1
C) exon 4
D) intron 1
E) A 5ʹ untranslated region would not be present in this figure.
Loading page 9...
Page 9
31. Given the figure below, within which of the following would the Shine–Dalgarno
sequence be located?
A) promoter
B) exon 1
C) exon 4
D) intron 1
E) A 5ʹ untranslated region would not be present in this figure.
32. Which of the following intron types requires spliceosomes for removal?
A) group I intron
B) group II intron
C) group III intron
D) nuclear pre-mRNA
E) tRNA
33. Which of the following intron types is present only in eukaryotes?
A) nuclear pre-mRNA
B) group I intron
C) group II intron
D) tRNA
E) group III intron
34. The calcitonin gene can encode either the hormone calcitonin or a protein called
calcitonin-gene-related peptide depending on which 3 cleavage site is used. In the
thyroid gland, cleavage and polyadenylation occur after the fourth exon leading to
calcitonin production. However, in the brain, the exact same transcript is cleaved after
the sixth exon yielding calcitonin-gene-related peptide. This is an example of:
A) multiple capping.
B) alternative RNA processing.
C) polyadenylation.
D) environmental influence.
E) mutation.
31. Given the figure below, within which of the following would the Shine–Dalgarno
sequence be located?
A) promoter
B) exon 1
C) exon 4
D) intron 1
E) A 5ʹ untranslated region would not be present in this figure.
32. Which of the following intron types requires spliceosomes for removal?
A) group I intron
B) group II intron
C) group III intron
D) nuclear pre-mRNA
E) tRNA
33. Which of the following intron types is present only in eukaryotes?
A) nuclear pre-mRNA
B) group I intron
C) group II intron
D) tRNA
E) group III intron
34. The calcitonin gene can encode either the hormone calcitonin or a protein called
calcitonin-gene-related peptide depending on which 3 cleavage site is used. In the
thyroid gland, cleavage and polyadenylation occur after the fourth exon leading to
calcitonin production. However, in the brain, the exact same transcript is cleaved after
the sixth exon yielding calcitonin-gene-related peptide. This is an example of:
A) multiple capping.
B) alternative RNA processing.
C) polyadenylation.
D) environmental influence.
E) mutation.
Loading page 10...
Page 10
35. Which of the following processes does NOT support the observation that the amino acid
sequence of a protein may not be the same as that encoded by its gene?
A) RNA editing
B) alternative splicing
C) multiple 3 cleavage sites
D) 5 capping
E) errors that occurred during transcription
36. The sequence below represents a pre-mRNA. Which of the following represents the
sequence of the spliced mRNA that would result from this pre-mRNA sequence?
mRNA: 5 ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3
A) 5 ACUGGACAGUCGGCACCACG 3
B) 5 GUAAGAAUACAAC 3
C) 5 UGACCUGUCAGCCGUGGUGC 3
D) 5 ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3
E) 5 AGAAUACAACACAGUCGGCACCACG 3
37. The sequence below represents a pre-mRNA. What would happen if the G in the 5ʹ
splice site were mutated to a C?
mRNA: 5 ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3
A) The U2 snRNA would not be able to bind to the branch point because it could not
recognize it.
B) The spliceosome complex would be degraded because it could no longer recognize
the 5ʹ splice site.
C) The U1 snRNA would not be able to bind complementarily to the 5ʹ splice site.
D) Splicing would still occur appropriately because the G is not essential at the 5ʹ
splice site.
E) The 5ʹ cap would not be able to be added because it requires the 5ʹ splice site to be
functional.
38. The 5ʹ cap in an mRNA plays a role in translation initiation. Which of the following
could be a plausible mechanism by which a 5ʹ cap could enhance initiation?
A) The 5ʹ cap could assist in bringing together the snRNPs for spliceosome assembly.
B) The 5ʹ cap could recruit proteins that would help to assemble the ribosomes.
C) The 5ʹ cap could assist in the identification of stop codons within the mRNA.
D) The 5ʹ cap could serve as a marker for the ribosome to locate promoters.
E) The 5ʹ cap could assist in the unwinding of the DNA to allow ribosome access to
the DNA.
35. Which of the following processes does NOT support the observation that the amino acid
sequence of a protein may not be the same as that encoded by its gene?
A) RNA editing
B) alternative splicing
C) multiple 3 cleavage sites
D) 5 capping
E) errors that occurred during transcription
36. The sequence below represents a pre-mRNA. Which of the following represents the
sequence of the spliced mRNA that would result from this pre-mRNA sequence?
mRNA: 5 ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3
A) 5 ACUGGACAGUCGGCACCACG 3
B) 5 GUAAGAAUACAAC 3
C) 5 UGACCUGUCAGCCGUGGUGC 3
D) 5 ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3
E) 5 AGAAUACAACACAGUCGGCACCACG 3
37. The sequence below represents a pre-mRNA. What would happen if the G in the 5ʹ
splice site were mutated to a C?
mRNA: 5 ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3
A) The U2 snRNA would not be able to bind to the branch point because it could not
recognize it.
B) The spliceosome complex would be degraded because it could no longer recognize
the 5ʹ splice site.
C) The U1 snRNA would not be able to bind complementarily to the 5ʹ splice site.
D) Splicing would still occur appropriately because the G is not essential at the 5ʹ
splice site.
E) The 5ʹ cap would not be able to be added because it requires the 5ʹ splice site to be
functional.
38. The 5ʹ cap in an mRNA plays a role in translation initiation. Which of the following
could be a plausible mechanism by which a 5ʹ cap could enhance initiation?
A) The 5ʹ cap could assist in bringing together the snRNPs for spliceosome assembly.
B) The 5ʹ cap could recruit proteins that would help to assemble the ribosomes.
C) The 5ʹ cap could assist in the identification of stop codons within the mRNA.
D) The 5ʹ cap could serve as a marker for the ribosome to locate promoters.
E) The 5ʹ cap could assist in the unwinding of the DNA to allow ribosome access to
the DNA.
Loading page 11...
Page 11
39. What would be the MOST likely effect of mutating the consensus sequence found at the
5' splice site of an intron?
A) A shorter than normal protein would be produced.
B) Replication would be inhibited.
C) A longer than normal mRNA would be produced.
D) A longer than normal DNA would be produced.
E) Transcription would terminate prematurely.
40. If a splice site were mutated so that splicing did not take place, what would be the effect
on the amino acid sequence?
A) It would be shorter than normal.
B) It would be longer than normal.
C) It would be the same length but would encode a different protein.
D) It would be unable to fold into its correct structure.
E) It depends on the mutant mRNA sequence.
41. When studying a plant's protein production, a scientist found two different proteins. The
first one contained amino acids from exons 1, 2, 3, 4, 5, and 6, while the second one
only contained amino acids from exons from 1, 2, and 3. Which of the following is
MOST likely responsible for this difference?
A) a mutation in the gene that encodes an miRNA
B) posttranslational modification
C) RNA editing
D) alternative RNA processing
E) a mutation in the gene that encodes a snoRNA
42. Suppose an organism ingests a drug that disassembles its spliceosomes, rendering them
nonfunctional. Which of the following would be seen MOST immediately in this
organism?
A) All translation would stop.
B) tRNA bases would no longer be modified into rare bases.
C) Introns would not be removed from the pre-mRNA.
D) mRNA would not be able to bind the 5ʹ cap.
E) rRNA would no longer be appropriately processed.
39. What would be the MOST likely effect of mutating the consensus sequence found at the
5' splice site of an intron?
A) A shorter than normal protein would be produced.
B) Replication would be inhibited.
C) A longer than normal mRNA would be produced.
D) A longer than normal DNA would be produced.
E) Transcription would terminate prematurely.
40. If a splice site were mutated so that splicing did not take place, what would be the effect
on the amino acid sequence?
A) It would be shorter than normal.
B) It would be longer than normal.
C) It would be the same length but would encode a different protein.
D) It would be unable to fold into its correct structure.
E) It depends on the mutant mRNA sequence.
41. When studying a plant's protein production, a scientist found two different proteins. The
first one contained amino acids from exons 1, 2, 3, 4, 5, and 6, while the second one
only contained amino acids from exons from 1, 2, and 3. Which of the following is
MOST likely responsible for this difference?
A) a mutation in the gene that encodes an miRNA
B) posttranslational modification
C) RNA editing
D) alternative RNA processing
E) a mutation in the gene that encodes a snoRNA
42. Suppose an organism ingests a drug that disassembles its spliceosomes, rendering them
nonfunctional. Which of the following would be seen MOST immediately in this
organism?
A) All translation would stop.
B) tRNA bases would no longer be modified into rare bases.
C) Introns would not be removed from the pre-mRNA.
D) mRNA would not be able to bind the 5ʹ cap.
E) rRNA would no longer be appropriately processed.
Loading page 12...
Page 12
43. Cystic fibrosis is caused by a mutation in the CFTR gene. The normal CFTR gene
comprises approximately 190,000 nucleotides and produces an mRNA of 6128
nucleotides in length. What is a possible explanation for the difference in the sizes of the
gene and the mRNA?
A) The promoter of the CFTR gene is likely silenced by miRNAs prior to mRNA
production.
B) The CFTR gene likely has many introns that are excised prior to translation of the
CFTR protein.
C) The 5ʹ cap and the poly(A) tail get removed prior to translation of the CFTR
protein.
D) Methylation of the 5ʹ cap silences portions of the gene, preventing those regions
from being transcribed into mRNA.
E) The mutation that causes cystic fibrosis creates a new terminator sequence,
resulting in a shorter mRNA.
44. Suppose a mutation occurred that prevented a eukaryotic pre-mRNA from receiving a 5ʹ
cap. What would be an expected result?
A) Transcription would continue past the end of the gene coding sequence resulting in
a longer pre-mRNA transcript.
B) Translation would continue past the end of the gene coding sequence resulting in a
longer pre-mRNA transcript.
C) Transcription would not occur as the transcription factors would not be able to bind
to the promoter.
D) Translation would not occur as the ribosome would not be able to bind to the
mRNA.
E) Replication would not occur as DNA polymerase would not be able to bind to the
DNA at the origin of replication.
45. In your own words, list a comprehensive definition for “gene” at the molecular level.
46. What is an snRNP and what role does it play in the cell?
47. What is a pulse–chase experiment? Explain how this technique can be used to follow the
products of a short-term event.
48. Devise and describe a strategy to conduct a pulse–chase experiment to determine if
newly transcribed eukaryotic RNA actually moves from the nucleus to the cytoplasm.
43. Cystic fibrosis is caused by a mutation in the CFTR gene. The normal CFTR gene
comprises approximately 190,000 nucleotides and produces an mRNA of 6128
nucleotides in length. What is a possible explanation for the difference in the sizes of the
gene and the mRNA?
A) The promoter of the CFTR gene is likely silenced by miRNAs prior to mRNA
production.
B) The CFTR gene likely has many introns that are excised prior to translation of the
CFTR protein.
C) The 5ʹ cap and the poly(A) tail get removed prior to translation of the CFTR
protein.
D) Methylation of the 5ʹ cap silences portions of the gene, preventing those regions
from being transcribed into mRNA.
E) The mutation that causes cystic fibrosis creates a new terminator sequence,
resulting in a shorter mRNA.
44. Suppose a mutation occurred that prevented a eukaryotic pre-mRNA from receiving a 5ʹ
cap. What would be an expected result?
A) Transcription would continue past the end of the gene coding sequence resulting in
a longer pre-mRNA transcript.
B) Translation would continue past the end of the gene coding sequence resulting in a
longer pre-mRNA transcript.
C) Transcription would not occur as the transcription factors would not be able to bind
to the promoter.
D) Translation would not occur as the ribosome would not be able to bind to the
mRNA.
E) Replication would not occur as DNA polymerase would not be able to bind to the
DNA at the origin of replication.
45. In your own words, list a comprehensive definition for “gene” at the molecular level.
46. What is an snRNP and what role does it play in the cell?
47. What is a pulse–chase experiment? Explain how this technique can be used to follow the
products of a short-term event.
48. Devise and describe a strategy to conduct a pulse–chase experiment to determine if
newly transcribed eukaryotic RNA actually moves from the nucleus to the cytoplasm.
Loading page 13...
Page 13
49. Describe the evidence that suggested that RNA was the carrier of genetic information
from the nucleus to the ribosome.
50. What are guide RNAs (gRNAs) and what do they do?
51. For a time, a gene was defined as a sequence of DNA that encodes a polypeptide.
Critique this outdated notion of what a gene is and propose a more comprehensive
definition.
52. Use the pre-mRNA sequence shown below to answer the following questions.
mRNA: 5 ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3
a. Underline the 5 and 3 splice sites, then write the sequence of the spliced mRNA
in the space provided.
b. Predict what would happen if the G in the 5 splice site were mutated to a C.
c. We learned in this chapter that the 5 cap in an mRNA plays a role in translation
initiation. What do you think is one plausible mechanism by which a 5 cap can enhance
initiation? How can you experimentally demonstrate that a 5 cap is important for this
process?
53. Explain how RNA editing violates a general principle of molecular genetics.
54. Devise a strategy to prove that splicing occurs in the nucleus.
55. Critique the idea that the information needed to encode a particular polypeptide always
resides within a single gene.
56. Which of the following nitrogenous bases is frequently modified enzymatically to
become a rare type of nitrogenous base in tRNA?
A) adenine
B) uracil
C) thymine
D) cytosine
E) guanine
49. Describe the evidence that suggested that RNA was the carrier of genetic information
from the nucleus to the ribosome.
50. What are guide RNAs (gRNAs) and what do they do?
51. For a time, a gene was defined as a sequence of DNA that encodes a polypeptide.
Critique this outdated notion of what a gene is and propose a more comprehensive
definition.
52. Use the pre-mRNA sequence shown below to answer the following questions.
mRNA: 5 ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3
a. Underline the 5 and 3 splice sites, then write the sequence of the spliced mRNA
in the space provided.
b. Predict what would happen if the G in the 5 splice site were mutated to a C.
c. We learned in this chapter that the 5 cap in an mRNA plays a role in translation
initiation. What do you think is one plausible mechanism by which a 5 cap can enhance
initiation? How can you experimentally demonstrate that a 5 cap is important for this
process?
53. Explain how RNA editing violates a general principle of molecular genetics.
54. Devise a strategy to prove that splicing occurs in the nucleus.
55. Critique the idea that the information needed to encode a particular polypeptide always
resides within a single gene.
56. Which of the following nitrogenous bases is frequently modified enzymatically to
become a rare type of nitrogenous base in tRNA?
A) adenine
B) uracil
C) thymine
D) cytosine
E) guanine
Loading page 14...
Page 14
57. Anticodons are found in _____ molecules.
A) mRNA
B) tRNA
C) rRNA
D) snRNA
E) miRNA
58. Which of the following observations supports the notion that the gene is simply a set of
DNA sequences that are transcribed into a single RNA molecule that encodes a single
polypeptide?
A) Alternative splicing—a single gene can yield multiple mRNA and protein products.
B) A single ribosomal RNA transcript can liberate several RNA molecules via further
processing.
C) RNAs can be the functional product of a gene without being translated into a
protein product.
D) Within a protein coding region, each codon represents a specific amino acid that
will be linked to form a polypeptide.
E) Regulatory elements are part of a gene that regulate timing, degree, and specificity
of gene expression but are not transcribed.
59. To which part on a tRNA would an amino acid attach during tRNA charging?
A) 3 acceptor arm
B) anticodon arm
C) TC arm
D) DHU arm
E) extra arm
60. Draw the tRNA cloverleaf secondary structure, labeling the various loops and stems.
Indicate the functions of the acceptor stem and the anticodon. How are modified bases
produced in tRNAs?
61. Compare and contrast the mechanisms of splicing for nuclear pre-mRNA introns, group
I introns, group II introns, and tRNA introns.
57. Anticodons are found in _____ molecules.
A) mRNA
B) tRNA
C) rRNA
D) snRNA
E) miRNA
58. Which of the following observations supports the notion that the gene is simply a set of
DNA sequences that are transcribed into a single RNA molecule that encodes a single
polypeptide?
A) Alternative splicing—a single gene can yield multiple mRNA and protein products.
B) A single ribosomal RNA transcript can liberate several RNA molecules via further
processing.
C) RNAs can be the functional product of a gene without being translated into a
protein product.
D) Within a protein coding region, each codon represents a specific amino acid that
will be linked to form a polypeptide.
E) Regulatory elements are part of a gene that regulate timing, degree, and specificity
of gene expression but are not transcribed.
59. To which part on a tRNA would an amino acid attach during tRNA charging?
A) 3 acceptor arm
B) anticodon arm
C) TC arm
D) DHU arm
E) extra arm
60. Draw the tRNA cloverleaf secondary structure, labeling the various loops and stems.
Indicate the functions of the acceptor stem and the anticodon. How are modified bases
produced in tRNAs?
61. Compare and contrast the mechanisms of splicing for nuclear pre-mRNA introns, group
I introns, group II introns, and tRNA introns.
Loading page 15...
Page 15
62. Which of the following rRNA components originates from a separate gene transcript
rather than as a cleaved product of a long single precursor rRNA transcript?
A) prokaryotic 16S rRNA
B) prokaryotic 23S rRNA
C) eukaryotic 18S rRNA
D) eukaryotic 5.8S rRNA
E) eukaryotic 5S rRNA
63. Below is a list of steps in the processing of ribosomal RNAs. Please select the choice
that lists the steps in the CORRECT sequential order.
1. Methyl groups added to specific bases and the 2-carbon atom of some ribose sugars
2. Transcription of the rRNA precursors from DNA
3. Cleavage of precursor rRNA
4. Individual rRNA molecules ready for ribosome assembly
5. Trimming of precursor rRNA
A) 3, 1, 2, 5, 4
B) 2, 3, 4, 5, 1
C) 4, 2, 3, 1, 5
D) 1, 3, 5, 4, 1
E) 2, 1, 3, 5, 4
64. A drug that destroyed small nucleolar RNA (snoRNA) would inhibit which process?
A) RNA splicing of pre-mRNA
B) translation
C) assembly of the nucleosome
D) replication
E) transcription
65. Which class of RNA is MOST abundant in cells?
A) mRNA
B) tRNA
C) rRNA
D) snRNA
E) miRNA
62. Which of the following rRNA components originates from a separate gene transcript
rather than as a cleaved product of a long single precursor rRNA transcript?
A) prokaryotic 16S rRNA
B) prokaryotic 23S rRNA
C) eukaryotic 18S rRNA
D) eukaryotic 5.8S rRNA
E) eukaryotic 5S rRNA
63. Below is a list of steps in the processing of ribosomal RNAs. Please select the choice
that lists the steps in the CORRECT sequential order.
1. Methyl groups added to specific bases and the 2-carbon atom of some ribose sugars
2. Transcription of the rRNA precursors from DNA
3. Cleavage of precursor rRNA
4. Individual rRNA molecules ready for ribosome assembly
5. Trimming of precursor rRNA
A) 3, 1, 2, 5, 4
B) 2, 3, 4, 5, 1
C) 4, 2, 3, 1, 5
D) 1, 3, 5, 4, 1
E) 2, 1, 3, 5, 4
64. A drug that destroyed small nucleolar RNA (snoRNA) would inhibit which process?
A) RNA splicing of pre-mRNA
B) translation
C) assembly of the nucleosome
D) replication
E) transcription
65. Which class of RNA is MOST abundant in cells?
A) mRNA
B) tRNA
C) rRNA
D) snRNA
E) miRNA
Loading page 16...
Page 16
66. Which of the following classes of RNAs is unique to eukaryotes?
A) messenger RNA (mRNA)
B) ribosomal RNA (rRNA)
C) transfer RNA (tRNA)
D) small nuclear RNAs (snRNAs)
E) CRISPR RNAs (crRNAs)
67. siRNAs and miRNAs function in which of the following processes?
A) transcription
B) translation
C) RNA interference
D) RNA editing
E) RNA splicing
68. What is the similarity between miRNAs, siRNAs, and piRNAs?
A) All three types originate from transposons or viruses and are found in all
organisms.
B) They all target and degrade the gene from which they were transcribed.
C) All three are generated from a single-stranded RNA that gets cleaved.
D) All three can influence chromatin structure, which, in turn, can influence gene
expression.
E) All three associate with Piwi proteins in order to mediate RNA degradation.
69. A scientist is studying a gene known as the XYZ gene in eukaryotes. Into a eukaryotic
cell, she inserts an miRNA that is complementary to a portion of the XYZ mRNA found
in the cell. What result would you predict?
A) There will be an increase in the amount of XYZ protein made.
B) There will be a decrease in the amount of XYZ protein made.
C) There will be an increase in the transcription of the XYZ gene.
D) There will be a decrease in the transcription of the XYZ gene.
E) No change will result from the insertion of the miRNA.
70. A scientist is studying a gene known as the ABC gene in bacteria. Into a bacterial cell,
she inserts an miRNA that is complementary to a portion of the ABC mRNA found in
the cell. What result would you predict?
A) There will be an increase in the amount of ABC protein made.
B) There will be a decrease in the amount of ABC protein made.
C) There will be an increase in the transcription of the ABC gene.
D) There will be a decrease in the transcription of the ABC gene.
E) No change will result from the insertion of the miRNA.
66. Which of the following classes of RNAs is unique to eukaryotes?
A) messenger RNA (mRNA)
B) ribosomal RNA (rRNA)
C) transfer RNA (tRNA)
D) small nuclear RNAs (snRNAs)
E) CRISPR RNAs (crRNAs)
67. siRNAs and miRNAs function in which of the following processes?
A) transcription
B) translation
C) RNA interference
D) RNA editing
E) RNA splicing
68. What is the similarity between miRNAs, siRNAs, and piRNAs?
A) All three types originate from transposons or viruses and are found in all
organisms.
B) They all target and degrade the gene from which they were transcribed.
C) All three are generated from a single-stranded RNA that gets cleaved.
D) All three can influence chromatin structure, which, in turn, can influence gene
expression.
E) All three associate with Piwi proteins in order to mediate RNA degradation.
69. A scientist is studying a gene known as the XYZ gene in eukaryotes. Into a eukaryotic
cell, she inserts an miRNA that is complementary to a portion of the XYZ mRNA found
in the cell. What result would you predict?
A) There will be an increase in the amount of XYZ protein made.
B) There will be a decrease in the amount of XYZ protein made.
C) There will be an increase in the transcription of the XYZ gene.
D) There will be a decrease in the transcription of the XYZ gene.
E) No change will result from the insertion of the miRNA.
70. A scientist is studying a gene known as the ABC gene in bacteria. Into a bacterial cell,
she inserts an miRNA that is complementary to a portion of the ABC mRNA found in
the cell. What result would you predict?
A) There will be an increase in the amount of ABC protein made.
B) There will be a decrease in the amount of ABC protein made.
C) There will be an increase in the transcription of the ABC gene.
D) There will be a decrease in the transcription of the ABC gene.
E) No change will result from the insertion of the miRNA.
Loading page 17...
Page 17
71. A microbiologist isolated a mutant strain of E. coli that is extremely susceptible to
bacteriophage infection, by a wide range of bacteriophages. Which of the following
genes might she explore as a possible site of the mutation that results in this phenotype?
A) A gene that encodes a small nucleolar RNA
B) A gene that encodes a Cas protein
C) A gene that encodes a Piwi-interacting RNA
D) A gene that encodes either a miRNA or a siRNA
E) A gene that encodes an immune RNA
72. What attributes make miRNA a potent agent for silencing gene expression by allowing
it to silence a large number of genes simultaneously?
73. Discuss the features of C. elegans that make it an important model system for studies of
animal genetics and development. Include in your answer some unique features of C.
elegans compared to other model systems.
74. Which of the following small RNA types is unique to prokaryotes?
A) siRNA
B) crRNA
C) miRNA
D) piRNA
E) lncRNA
75. Which of the following regulatory RNA types is different from the rest in terms of its
length?
A) siRNA
B) crRNA
C) miRNA
D) piRNA
E) lncRNA
71. A microbiologist isolated a mutant strain of E. coli that is extremely susceptible to
bacteriophage infection, by a wide range of bacteriophages. Which of the following
genes might she explore as a possible site of the mutation that results in this phenotype?
A) A gene that encodes a small nucleolar RNA
B) A gene that encodes a Cas protein
C) A gene that encodes a Piwi-interacting RNA
D) A gene that encodes either a miRNA or a siRNA
E) A gene that encodes an immune RNA
72. What attributes make miRNA a potent agent for silencing gene expression by allowing
it to silence a large number of genes simultaneously?
73. Discuss the features of C. elegans that make it an important model system for studies of
animal genetics and development. Include in your answer some unique features of C.
elegans compared to other model systems.
74. Which of the following small RNA types is unique to prokaryotes?
A) siRNA
B) crRNA
C) miRNA
D) piRNA
E) lncRNA
75. Which of the following regulatory RNA types is different from the rest in terms of its
length?
A) siRNA
B) crRNA
C) miRNA
D) piRNA
E) lncRNA
Loading page 18...
Page 18
Answer Key
1. A
2. D
3. B
4. C
5. B
6. D
7. D
8. A
9. D
10. A
11. E
12. B
13. E
14. D
15. C
16. D
17. D
18. E
19. D
20. D
21. C
22. A
23. A
24. D
25. D
26. A
27. C
28. C
29. E
30. B
31. E
32. D
33. A
34. B
35. D
36. A
37. C
38. B
39. C
40. E
41. D
42. C
43. B
44. D
Answer Key
1. A
2. D
3. B
4. C
5. B
6. D
7. D
8. A
9. D
10. A
11. E
12. B
13. E
14. D
15. C
16. D
17. D
18. E
19. D
20. D
21. C
22. A
23. A
24. D
25. D
26. A
27. C
28. C
29. E
30. B
31. E
32. D
33. A
34. B
35. D
36. A
37. C
38. B
39. C
40. E
41. D
42. C
43. B
44. D
Loading page 19...
Page 19
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56. B
57. B
58. D
59. A
60.
61.
62. E
63. E
64. B
65. C
66. D
67. C
68. D
69. B
70. E
71. B
72.
73.
74. B
75. E
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56. B
57. B
58. D
59. A
60.
61.
62. E
63. E
64. B
65. C
66. D
67. C
68. D
69. B
70. E
71. B
72.
73.
74. B
75. E
Loading page 20...
Page 1
1. In the introduction to this chapter, the use of the CRISPR-Cas9 system to make a
deletion of exon 23 containing a premature stop codon in mdx mice was described. The
resulting mice had partially restored dystrophin protein and muscle function. Which of
the following CRISRP-Cas9 mediated changes might lead to a better restoration of
dystrophin protein and muscle function?
A) A deletion of exon 24 in addition to exon 23
B) A deletion of intron 23
C) A deletion of 30 bases within exon 23
D) A deletion of 25 bases within exon 21
E) An insertion of a corrected copy of exon 23 after the mutant exon 23
2. Which of the following statements does NOT describe a challenge of working at the
molecular level?
A) Cells contain thousands of genes.
B) Individual genes cannot be seen.
C) It is not possible to isolate DNA in a stable form.
D) A genome can consist of billions of base pairs.
E) No physical features mark the beginning or end of a gene.
3. Which of the following is a set of molecular techniques for locating, isolating, altering,
and studying DNA segments?
A) in situ hybridization
B) gel electrophoresis
C) molecular cloning
D) Southern blotting
E) recombinant DNA technology
4. Gel electrophoresis can be used to separate DNA on the basis of:
A) size.
B) electrical charge.
C) nucleotide content.
D) the probe used.
E) both size and electrical charge.
5. Which of the following statements is NOT correct regarding type II restriction
enzymes?
A) They can create blunt ends.
B) They make double-stranded cuts in DNA.
C) They recognize specific sequences and make cuts further away from the
recognition sequence.
D) They are named based on their bacterial origin.
1. In the introduction to this chapter, the use of the CRISPR-Cas9 system to make a
deletion of exon 23 containing a premature stop codon in mdx mice was described. The
resulting mice had partially restored dystrophin protein and muscle function. Which of
the following CRISRP-Cas9 mediated changes might lead to a better restoration of
dystrophin protein and muscle function?
A) A deletion of exon 24 in addition to exon 23
B) A deletion of intron 23
C) A deletion of 30 bases within exon 23
D) A deletion of 25 bases within exon 21
E) An insertion of a corrected copy of exon 23 after the mutant exon 23
2. Which of the following statements does NOT describe a challenge of working at the
molecular level?
A) Cells contain thousands of genes.
B) Individual genes cannot be seen.
C) It is not possible to isolate DNA in a stable form.
D) A genome can consist of billions of base pairs.
E) No physical features mark the beginning or end of a gene.
3. Which of the following is a set of molecular techniques for locating, isolating, altering,
and studying DNA segments?
A) in situ hybridization
B) gel electrophoresis
C) molecular cloning
D) Southern blotting
E) recombinant DNA technology
4. Gel electrophoresis can be used to separate DNA on the basis of:
A) size.
B) electrical charge.
C) nucleotide content.
D) the probe used.
E) both size and electrical charge.
5. Which of the following statements is NOT correct regarding type II restriction
enzymes?
A) They can create blunt ends.
B) They make double-stranded cuts in DNA.
C) They recognize specific sequences and make cuts further away from the
recognition sequence.
D) They are named based on their bacterial origin.
Loading page 21...
Page 2
6. Which of the following statements CORRECTLY describes DNA ligase?
A) DNA ligase forms hydrogen bonds between nucleotide bases.
B) DNA ligase can seal nicks between amino acids.
C) DNA ligase recognizes and cuts at specific sequences.
D) DNA ligase is necessary for creating recombinant plasmids.
E) DNA ligase is a requirement of a sequencing reaction.
7. Southern blotting is a technique used to transfer _____ to a solid Moderate.
A) DNA
B) RNA
C) protein
D) DNA and RNA
E) DNA, RNA, or protein
8. Antibodies are to Western blots as _____ is/are to Southern blots.
A) RNA probes
B) proteins
C) DNA probes
D) amino acids
E) DNA or RNA probes
9. Which of the following would be MOST appropriate for cloning a gene that is 300 kb in
size?
A) plasmid
B) cosmid
C) phage lambda
D) BAC
E) yeast phage
10. A gene does not contain the necessary restriction enzyme sites for cloning into a
plasmid vector. What is a possible option?
A) Increase the amount of gene used.
B) Add linkers to generate new restriction enzyme sites.
C) Use a cosmid as a cloning vector.
D) Use dideoxy sequencing to obtain the sequence of the gene.
E) Cut the DNA with a blunt end cutter.
6. Which of the following statements CORRECTLY describes DNA ligase?
A) DNA ligase forms hydrogen bonds between nucleotide bases.
B) DNA ligase can seal nicks between amino acids.
C) DNA ligase recognizes and cuts at specific sequences.
D) DNA ligase is necessary for creating recombinant plasmids.
E) DNA ligase is a requirement of a sequencing reaction.
7. Southern blotting is a technique used to transfer _____ to a solid Moderate.
A) DNA
B) RNA
C) protein
D) DNA and RNA
E) DNA, RNA, or protein
8. Antibodies are to Western blots as _____ is/are to Southern blots.
A) RNA probes
B) proteins
C) DNA probes
D) amino acids
E) DNA or RNA probes
9. Which of the following would be MOST appropriate for cloning a gene that is 300 kb in
size?
A) plasmid
B) cosmid
C) phage lambda
D) BAC
E) yeast phage
10. A gene does not contain the necessary restriction enzyme sites for cloning into a
plasmid vector. What is a possible option?
A) Increase the amount of gene used.
B) Add linkers to generate new restriction enzyme sites.
C) Use a cosmid as a cloning vector.
D) Use dideoxy sequencing to obtain the sequence of the gene.
E) Cut the DNA with a blunt end cutter.
Loading page 22...
Page 3
11. All of the following are requirements of a bacterial cloning vector EXCEPT:
A) origin of replication.
B) unique restriction enzyme sites.
C) Ti plasmid.
D) selectable markers.
12. During gel electrophoresis, large DNA fragments will _____ small DNA fragments.
A) migrate more rapidly than
B) migrate at the same speed as
C) migrate more slowly than
D) cause degradation of
E) separate into
13. You are interested in a particular segment of rhinoceros DNA and would like to clone it
into a cloning plasmid. You have the following restriction map of the region that
includes the DNA of interest and the plasmid (E = EcoRI, H = HindIII, X = XbaI, S =
SphI, N = NotI).
Which restriction enzymes would you choose to clone the DNA of interest into the
cloning vector?
A) E and H
B) S
C) X and N
D) S and N
11. All of the following are requirements of a bacterial cloning vector EXCEPT:
A) origin of replication.
B) unique restriction enzyme sites.
C) Ti plasmid.
D) selectable markers.
12. During gel electrophoresis, large DNA fragments will _____ small DNA fragments.
A) migrate more rapidly than
B) migrate at the same speed as
C) migrate more slowly than
D) cause degradation of
E) separate into
13. You are interested in a particular segment of rhinoceros DNA and would like to clone it
into a cloning plasmid. You have the following restriction map of the region that
includes the DNA of interest and the plasmid (E = EcoRI, H = HindIII, X = XbaI, S =
SphI, N = NotI).
Which restriction enzymes would you choose to clone the DNA of interest into the
cloning vector?
A) E and H
B) S
C) X and N
D) S and N
Loading page 23...
Page 4
14.
The recognition site for BamHI is 5' GGATCC 3'
3' CCTAGG 3'
. Which of the following
restriction sites when digested would create a cohesive end that could be ligated to a
BamHI digested DNA fragment?
A)
EcoRII 5' C CAGG 3'
3' GGTCC 5'
B)
PvuII 5' CA GC TG 3'
3' GT CG AC 5'
C)
EcoRI 5' GAATTC 3'
3' CTTAAG 5'
D)
BglII 5' AG ATCT 3'
3' TCTA GA 5'
E)
CofI 5' GCGC 3'
3' CGCG 5'
15. Which of the following traits of type I restriction enzymes make them unsuitable for
recombinant DNA technology? (Select all that apply.)
A) They are large, multi-subunit enzymes.
B) They make double-stranded cuts in DNA.
C) They cleave and methylate DNA.
D) They cleave at sequences far from their recognition site.
E) They were discovered in bacteria.
16. A scientist attempts to use the CRISPR-Cas9 system to edit a single gene within a cell.
She finds that, in addition to editing the desired gene, she has edited several other genes
as well. What are reasonable options for her to try next in order to target just the gene of
interest? (Select all that apply.)
A) Add less Cas9 enzyme.
B) Create a longer sgRNA.
C) Try a different sgRNA that will still pair within the gene of interest.
D) Use separate crRNA and tracrRNA molecules.
E) Use a higher-fidelity version of Cas9.
14.
The recognition site for BamHI is 5' GGATCC 3'
3' CCTAGG 3'
. Which of the following
restriction sites when digested would create a cohesive end that could be ligated to a
BamHI digested DNA fragment?
A)
EcoRII 5' C CAGG 3'
3' GGTCC 5'
B)
PvuII 5' CA GC TG 3'
3' GT CG AC 5'
C)
EcoRI 5' GAATTC 3'
3' CTTAAG 5'
D)
BglII 5' AG ATCT 3'
3' TCTA GA 5'
E)
CofI 5' GCGC 3'
3' CGCG 5'
15. Which of the following traits of type I restriction enzymes make them unsuitable for
recombinant DNA technology? (Select all that apply.)
A) They are large, multi-subunit enzymes.
B) They make double-stranded cuts in DNA.
C) They cleave and methylate DNA.
D) They cleave at sequences far from their recognition site.
E) They were discovered in bacteria.
16. A scientist attempts to use the CRISPR-Cas9 system to edit a single gene within a cell.
She finds that, in addition to editing the desired gene, she has edited several other genes
as well. What are reasonable options for her to try next in order to target just the gene of
interest? (Select all that apply.)
A) Add less Cas9 enzyme.
B) Create a longer sgRNA.
C) Try a different sgRNA that will still pair within the gene of interest.
D) Use separate crRNA and tracrRNA molecules.
E) Use a higher-fidelity version of Cas9.
Loading page 24...
Page 5
17. A scientist is studying a normal tissue sample and a cancerous tissue sample. What
method might she use to determine whether the transcription of gene X is upregulated in
the cancerous tissue sample?
A) Carrying out a Southern blot using the cancerous tissue sample only
B) Carrying out a Southern blot using both samples
C) Carrying out a Northern blot using the cancerous tissue sample only
D) Carrying out a Northern blot using both samples
E) Carrying out a Western blot using the cancerous tissue sample only
18. A scientist edits a mammalian genome by inserting a GFP reporter sequence
downstream of a gene of interest. Which of the following methods is she likely to have
used to make this change?
A) site-directed mutagenesis
B) oligonucleotide-directed mutagenesis
C) CRISPR-Cas9 genome editing followed by nonhomologous end joining (NHEJ)
D) CRISPR-Cas9 genome editing followed by homologous recombination (HR) with
a donor template
E) mutagenesis with radiation
19. The haploid human genome contains about 3 × 109 nucleotides. On average, how
many DNA fragments would be produced if this DNA was digested with restriction
enzyme PstI (a 6-base cutter)? RsaI (a 4-base cutter)? How often would an 8-base cutter
cleave?
20. What are Northern analyses used for? Describe the steps involved in performing a
Northern analysis, and describe how levels of gene expression are determined.
17. A scientist is studying a normal tissue sample and a cancerous tissue sample. What
method might she use to determine whether the transcription of gene X is upregulated in
the cancerous tissue sample?
A) Carrying out a Southern blot using the cancerous tissue sample only
B) Carrying out a Southern blot using both samples
C) Carrying out a Northern blot using the cancerous tissue sample only
D) Carrying out a Northern blot using both samples
E) Carrying out a Western blot using the cancerous tissue sample only
18. A scientist edits a mammalian genome by inserting a GFP reporter sequence
downstream of a gene of interest. Which of the following methods is she likely to have
used to make this change?
A) site-directed mutagenesis
B) oligonucleotide-directed mutagenesis
C) CRISPR-Cas9 genome editing followed by nonhomologous end joining (NHEJ)
D) CRISPR-Cas9 genome editing followed by homologous recombination (HR) with
a donor template
E) mutagenesis with radiation
19. The haploid human genome contains about 3 × 109 nucleotides. On average, how
many DNA fragments would be produced if this DNA was digested with restriction
enzyme PstI (a 6-base cutter)? RsaI (a 4-base cutter)? How often would an 8-base cutter
cleave?
20. What are Northern analyses used for? Describe the steps involved in performing a
Northern analysis, and describe how levels of gene expression are determined.
Loading page 25...
Page 6
21. You are attempting to determine whether a plant-derived processed food sample (for
example, a corn chip) contains material from a genetically modified organism
(GMO). First, you crush the sample and attempt to extract DNA from it. Next, you
perform PCR using two different sets of primers. One primer set will amplify a DNA
sequence present in all plants. The second primer set will amplify a DNA sequence only
found in GMO plants.
a. Why must you use both sets of primers for this experiment?
b. In addition to the test sample, you obtain a negative control sample (food
material you are certain does not contain GMO material) and a positive control sample
(food material you are certain does contain GMO material). You perform the DNA
extraction on these three samples and then the PCR reactions with each of the two
primer sets described above. Complete the following table with your expectations for
this PCR reaction.
c. You obtain the results shown in the panel below. What conclusions can you draw
from these reaction results? Does this test sample contain genetically modified
components? Why or why not?
21. You are attempting to determine whether a plant-derived processed food sample (for
example, a corn chip) contains material from a genetically modified organism
(GMO). First, you crush the sample and attempt to extract DNA from it. Next, you
perform PCR using two different sets of primers. One primer set will amplify a DNA
sequence present in all plants. The second primer set will amplify a DNA sequence only
found in GMO plants.
a. Why must you use both sets of primers for this experiment?
b. In addition to the test sample, you obtain a negative control sample (food
material you are certain does not contain GMO material) and a positive control sample
(food material you are certain does contain GMO material). You perform the DNA
extraction on these three samples and then the PCR reactions with each of the two
primer sets described above. Complete the following table with your expectations for
this PCR reaction.
c. You obtain the results shown in the panel below. What conclusions can you draw
from these reaction results? Does this test sample contain genetically modified
components? Why or why not?
Loading page 26...
Page 7
Use the following to answer questions 22-23:
Figure A below shows a restriction map of a rare prokaryotic gene with its direction of
transcription indicated by the arrow. Figure B shows the unique restriction sites contained within
a plasmid-cloning vector. The blackened region in Figure A represents the amino acid coding
sequence of a protein that can be used in humans as a vaccine. The striped region in Figure B is a
highly active, constitutive (unregulated) prokaryotic promoter region. Letters indicate the
cleavage sites for different restriction enzymes. Known DNA sequences are indicated by short
thick lines.
22. Explain how you would isolate and then insert the coding region (Figure A) under the
control of the indicated promoter in the cloning vector (Figure B) to produce large
amounts of the protein in bacterial cells. Assume that the cloning vector carries the gene
for tetracycline (an antibiotic) resistance.
23. After trying to isolate and then insert the coding region (Figure A) under the control of
the indicated promoter in the cloning vector (Figure B), you found that all the
transformed bacterial cells contained either one of two smaller portions of the coding
region for the gene, and some of the fragments were inserted backward (with regard to
reading frame) into the cloning vector. How would you explain these observations?
24. What is the purpose of Taq polymerase in a PCR reaction?
A) DNA denaturation
B) primer annealing
C) DNA synthesis
D) heating of the reaction
E) heating of the reaction and DNA denaturation
Use the following to answer questions 22-23:
Figure A below shows a restriction map of a rare prokaryotic gene with its direction of
transcription indicated by the arrow. Figure B shows the unique restriction sites contained within
a plasmid-cloning vector. The blackened region in Figure A represents the amino acid coding
sequence of a protein that can be used in humans as a vaccine. The striped region in Figure B is a
highly active, constitutive (unregulated) prokaryotic promoter region. Letters indicate the
cleavage sites for different restriction enzymes. Known DNA sequences are indicated by short
thick lines.
22. Explain how you would isolate and then insert the coding region (Figure A) under the
control of the indicated promoter in the cloning vector (Figure B) to produce large
amounts of the protein in bacterial cells. Assume that the cloning vector carries the gene
for tetracycline (an antibiotic) resistance.
23. After trying to isolate and then insert the coding region (Figure A) under the control of
the indicated promoter in the cloning vector (Figure B), you found that all the
transformed bacterial cells contained either one of two smaller portions of the coding
region for the gene, and some of the fragments were inserted backward (with regard to
reading frame) into the cloning vector. How would you explain these observations?
24. What is the purpose of Taq polymerase in a PCR reaction?
A) DNA denaturation
B) primer annealing
C) DNA synthesis
D) heating of the reaction
E) heating of the reaction and DNA denaturation
Loading page 27...
Page 8
25. Which of the following is NOT a bacterial cloning vector?
A) plasmid
B) bacteriophage
C) agrobacterium
D) bacterial artificial chromosome
E) cosmid
26. Which of the following is NOT a potential benefit of using transgenic plants?
A) They can reduce the use of harmful chemical pesticides in the United States and
thus provide an ecological benefit.
B) They can generate restriction enzyme sites on a foreign gene of interest to be
cloned.
C) They often increase yields, providing more food per acre and reducing the amount
of land needed for agricultural use.
D) They can allow crops to be grown on land previously unavailable for productive
agricultural use.
E) They can be used to express large quantities of specific biological products more
cheaply and quickly than by expression in animal systems.
27. The difference between PCR and real-time PCR is that real-time PCR:
A) can measure the amount of DNA amplified as the reaction proceeds, while standard
PCR cannot.
B) can amplify DNA a billion-fold within just a few hours, while standard PCR
cannot.
C) can determine the DNA sequence, while standard PCR cannot.
D) uses DNA polymerase, while standard PCR does not.
E) requires primers, while standard PCR does not.
28. Which of the following represents an appropriate cloning vector for cloning a gene into
a bacterial cell?
A) YAC
B) Ti plasmid
C) plasmid
D) Agrobacterium tumefaciens
E) lacZ
25. Which of the following is NOT a bacterial cloning vector?
A) plasmid
B) bacteriophage
C) agrobacterium
D) bacterial artificial chromosome
E) cosmid
26. Which of the following is NOT a potential benefit of using transgenic plants?
A) They can reduce the use of harmful chemical pesticides in the United States and
thus provide an ecological benefit.
B) They can generate restriction enzyme sites on a foreign gene of interest to be
cloned.
C) They often increase yields, providing more food per acre and reducing the amount
of land needed for agricultural use.
D) They can allow crops to be grown on land previously unavailable for productive
agricultural use.
E) They can be used to express large quantities of specific biological products more
cheaply and quickly than by expression in animal systems.
27. The difference between PCR and real-time PCR is that real-time PCR:
A) can measure the amount of DNA amplified as the reaction proceeds, while standard
PCR cannot.
B) can amplify DNA a billion-fold within just a few hours, while standard PCR
cannot.
C) can determine the DNA sequence, while standard PCR cannot.
D) uses DNA polymerase, while standard PCR does not.
E) requires primers, while standard PCR does not.
28. Which of the following represents an appropriate cloning vector for cloning a gene into
a bacterial cell?
A) YAC
B) Ti plasmid
C) plasmid
D) Agrobacterium tumefaciens
E) lacZ
Loading page 28...
Page 9
29. Ampicillin resistance is to ampR as _____ is to lacZ.
A) Bt toxin
B) G418
C) cleavage of X-gal
D) penicillin resistance
E) gancyclovir
30. Which of the following can be used for genetic engineering in plants?
A) Ti plasmid
B) Agrobacterium tumefaciens
C) selectable markers
D) Ti plasmids and Agrobacterium tumefaciens only
E) Ti plasmids, Agrobacterium tumefaciens, and selectable markers
31. Which of the following statements is NOT true regarding the basic components required
for a bacterial cloning vector?
A) Selectable markers provide a means for preferentially allowing growth of only
those bacterial cells that have been transformed with the cloning vector.
B) Unique restriction enzyme sites allow for larger pieces of foreign DNA to be
inserted into the bacterial cloning vector.
C) Unique restriction enzyme sites provide a means for inserting the foreign DNA into
the cloning vector at a specific known sequence site.
D) A bacterial origin of replication ensures that the plasmid is replicated while present
within the bacterial cell.
E) Selectable markers provide a means for selecting cells that have been transformed
with a recombinant plasmid.
32. You have discovered a gene that enables organisms to accumulate gold in their tissues
by concentrating trace amounts found in normal soil. You want to transfer this gene into
a plant. Order the steps below that would accomplish this goal.
1. Infect the plant with the Agrobacterium strain.
2. Digest the gold gene and a Ti plasmid with appropriate restriction enzymes.
3. Insert the gold gene into the Ti plasmid.
4. Amplify the gold gene with PCR.
5. Transfer the recombinant Ti plasmid into Agrobacterium tumefaciens.
6. Use a selectable marker to identify plant cells that have integrated the
recombinant plasmid into their genome.
A) 4, 2, 3, 5, 1, 6
B) 4, 5, 2, 3, 1, 6
C) 4, 2, 5, 1, 6, 3
D) 4, 3, 2, 5, 1, 6
29. Ampicillin resistance is to ampR as _____ is to lacZ.
A) Bt toxin
B) G418
C) cleavage of X-gal
D) penicillin resistance
E) gancyclovir
30. Which of the following can be used for genetic engineering in plants?
A) Ti plasmid
B) Agrobacterium tumefaciens
C) selectable markers
D) Ti plasmids and Agrobacterium tumefaciens only
E) Ti plasmids, Agrobacterium tumefaciens, and selectable markers
31. Which of the following statements is NOT true regarding the basic components required
for a bacterial cloning vector?
A) Selectable markers provide a means for preferentially allowing growth of only
those bacterial cells that have been transformed with the cloning vector.
B) Unique restriction enzyme sites allow for larger pieces of foreign DNA to be
inserted into the bacterial cloning vector.
C) Unique restriction enzyme sites provide a means for inserting the foreign DNA into
the cloning vector at a specific known sequence site.
D) A bacterial origin of replication ensures that the plasmid is replicated while present
within the bacterial cell.
E) Selectable markers provide a means for selecting cells that have been transformed
with a recombinant plasmid.
32. You have discovered a gene that enables organisms to accumulate gold in their tissues
by concentrating trace amounts found in normal soil. You want to transfer this gene into
a plant. Order the steps below that would accomplish this goal.
1. Infect the plant with the Agrobacterium strain.
2. Digest the gold gene and a Ti plasmid with appropriate restriction enzymes.
3. Insert the gold gene into the Ti plasmid.
4. Amplify the gold gene with PCR.
5. Transfer the recombinant Ti plasmid into Agrobacterium tumefaciens.
6. Use a selectable marker to identify plant cells that have integrated the
recombinant plasmid into their genome.
A) 4, 2, 3, 5, 1, 6
B) 4, 5, 2, 3, 1, 6
C) 4, 2, 5, 1, 6, 3
D) 4, 3, 2, 5, 1, 6
Loading page 29...
Page 10
33. Consider a tobacco plant cell that was able to express a toxin that was lethal to insects
and was resistant to the antibiotic kanamycin. Which of the following genes would this
cell contain?
A) Bt
B) neo+
C) lacZ
D) Bt and neo+ only
E) Bt, neo+, and lacZ
Use the following to answer questions 34-36:
A student carries out PCR using the following steps:
Step 1: 94°C for 1 minute
Step 2: 60°C for 30 seconds
Step 3: 72°C for 30 seconds
34. Which of the following lists the CORRECT terms for these three steps?
A) denaturation of the double-stranded template, extension of the new DNA
molecules, primer annealing
B) denaturation of the double-stranded template, primer annealing, extension of the
new DNA molecules
C) denaturation of the double-stranded template, extension of the new DNA
molecules, hybridization of the template
D) degradation of the template, primer annealing, extension of the new DNA
molecules
E) hybridization of the single-stranded templates, primer annealing, extension of the
new DNA molecules
35. After subjecting his PCR reaction to gel electrophoresis, the student sees no PCR
product on the gel. What error(s) might he have made? (Select all that apply.)
A) He carried out step 1 at too low a temperature.
B) He carried out step 1 at too high a temperature.
C) He carried out step 2 at too low a temperature.
D) He carried out step 2 at too high a temperature.
E) He carried out step 3 for too short a time.
33. Consider a tobacco plant cell that was able to express a toxin that was lethal to insects
and was resistant to the antibiotic kanamycin. Which of the following genes would this
cell contain?
A) Bt
B) neo+
C) lacZ
D) Bt and neo+ only
E) Bt, neo+, and lacZ
Use the following to answer questions 34-36:
A student carries out PCR using the following steps:
Step 1: 94°C for 1 minute
Step 2: 60°C for 30 seconds
Step 3: 72°C for 30 seconds
34. Which of the following lists the CORRECT terms for these three steps?
A) denaturation of the double-stranded template, extension of the new DNA
molecules, primer annealing
B) denaturation of the double-stranded template, primer annealing, extension of the
new DNA molecules
C) denaturation of the double-stranded template, extension of the new DNA
molecules, hybridization of the template
D) degradation of the template, primer annealing, extension of the new DNA
molecules
E) hybridization of the single-stranded templates, primer annealing, extension of the
new DNA molecules
35. After subjecting his PCR reaction to gel electrophoresis, the student sees no PCR
product on the gel. What error(s) might he have made? (Select all that apply.)
A) He carried out step 1 at too low a temperature.
B) He carried out step 1 at too high a temperature.
C) He carried out step 2 at too low a temperature.
D) He carried out step 2 at too high a temperature.
E) He carried out step 3 for too short a time.
Loading page 30...
Page 11
36. After electrophoresing his PCR reaction, the student sees the desired PCR product on
the gel as well as several smaller bands. What error(s) might he have made? (Select all
that apply.)
A) He carried out step 2 at too low a temperature
B) He carried out step 2 at too high a temperature.
C) He designed primers with repetitive sequences.
D) He contaminated the template DNA sample.
E) He carried out step 3 for too short a time.
Use the following to answer questions 37-38:
A scientist carries out a ligation reaction designed to insert a foreign piece of DNA into a
plasmid that contains the front end of the lacZ gene within the multiple cloning site (MCS). He
carries out three transformations in parallel with lacZ– bacteria. The three transformations (i, ii,
and iii) contain the following:
i. sterile water
ii. a sample of the original plasmid
iii. the ligation reaction
He then plates the transformations on medium containing X-gal and ampicillin.
37. What results would indicate the scientist should proceed to culture colonies from (iii)
that might contain the desired clone?
A) Many blue colonies on all three plates.
B) White colonies on plates (i) and (ii) and predominantly blue colonies on plate (iii).
C) No colonies on plate (i), white colonies on plate (ii), and predominantly blue
colonies on plate (iii).
D) No colonies on plate (i), blue colonies on plate (ii), and predominantly white
colonies on plate (iii).
E) No colonies on plate (i), blue colonies on plate (ii), and predominantly blue
colonies on plate (iii).
38. The scientist observed colonies on plate (i). Which of the following might be reasons(s)
for this? (Select all that apply.)
A) The plasmid he used has a kanamycin resistance marker instead of an ampicillin
resistance marker.
B) He transformed cells that were not actually ampicillin sensitive.
C) Too high a concentration of ampicillin was added to the plates.
D) Too low a concentration of ampicillin was added to the plates.
E) The water sample was contaminated with the original plasmid.
36. After electrophoresing his PCR reaction, the student sees the desired PCR product on
the gel as well as several smaller bands. What error(s) might he have made? (Select all
that apply.)
A) He carried out step 2 at too low a temperature
B) He carried out step 2 at too high a temperature.
C) He designed primers with repetitive sequences.
D) He contaminated the template DNA sample.
E) He carried out step 3 for too short a time.
Use the following to answer questions 37-38:
A scientist carries out a ligation reaction designed to insert a foreign piece of DNA into a
plasmid that contains the front end of the lacZ gene within the multiple cloning site (MCS). He
carries out three transformations in parallel with lacZ– bacteria. The three transformations (i, ii,
and iii) contain the following:
i. sterile water
ii. a sample of the original plasmid
iii. the ligation reaction
He then plates the transformations on medium containing X-gal and ampicillin.
37. What results would indicate the scientist should proceed to culture colonies from (iii)
that might contain the desired clone?
A) Many blue colonies on all three plates.
B) White colonies on plates (i) and (ii) and predominantly blue colonies on plate (iii).
C) No colonies on plate (i), white colonies on plate (ii), and predominantly blue
colonies on plate (iii).
D) No colonies on plate (i), blue colonies on plate (ii), and predominantly white
colonies on plate (iii).
E) No colonies on plate (i), blue colonies on plate (ii), and predominantly blue
colonies on plate (iii).
38. The scientist observed colonies on plate (i). Which of the following might be reasons(s)
for this? (Select all that apply.)
A) The plasmid he used has a kanamycin resistance marker instead of an ampicillin
resistance marker.
B) He transformed cells that were not actually ampicillin sensitive.
C) Too high a concentration of ampicillin was added to the plates.
D) Too low a concentration of ampicillin was added to the plates.
E) The water sample was contaminated with the original plasmid.
Loading page 31...
28 more pages available. Scroll down to load them.
Preview Mode
Sign in to access the full document!
100%
Study Now!
XY-Copilot AI
Unlimited Access
Secure Payment
Instant Access
24/7 Support
AI Assistant
Document Details
Subject
Biology